Strain Game
Could information about a lab-made virus really help evildoers create a biological weapon?
Photograph by Chad Baker/Ryan McVay.
Here is one of the scariest things you’ll ever read:
atggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccact
gtggaccatatggccataatcaagaaat
These are the first 100 units of a gene in an influenza virus. This particular flu virus belongs to a strain called H5N1. It breeds and spreads among birds, but on rare occasion, it can infect people. And when it does, it is frighteningly fatal, with a mortality rate of about 60 percent. Since the virus was first spotted in Hong Kong in 1997, birds have spread it to many countries. On Dec. 19, it claimed its latest victim, a 29-year-old Egyptian man who probably contracted it from the chickens in his backyard. The only consolation for such deaths is that there are not more of them. The virus has proved unable to spread from person to person since it first emerged 14 years ago.
In the decade and a half since, scientists have put great effort into understanding the virus, worried that it might evolve into a pandemic that could cause a worldwide disaster. But now some new experiments on bird flu have plunged the scientific community into a debate about the risks of learning—and sharing—the virus’s secrets. Researchers have produced a variant of H5N1 that reportedly can spread from one mammal to another. So far they’ve documented its spread in ferrets; no one knows what it would do if it got out of the lab. But fearing the information could be used to create a biological weapon, a federal advisory board has taken the unprecedented step of calling for some of the results to be withheld from any published papers about the work.
A number of scientists agree with the board, saying that publishing too much information about this research could make it possible for terrorists to weaponize the flu. But others are warning that withholding data won’t make us safe, and that the best defense against bioterror—both human and natural—is transparency. Steffen Mueller, a virologist at Stony Brook University, says, “I much prefer dealing with the devil I know over the devil I don't.”
Transparency is one of the most cherished values in modern science; it allows scientists to build on one another’s research—and check each other’s work. In 2004, for example, an international team of scientists isolated an H5N1 virus and sequenced all 10 of its genes. They described the virus in the journal Nature, and they uploaded the entire genome to a website run by the National Library of Medicine. And so, if you’re a fan of this genre of virus horror nonfiction, you can read the whole thing for yourself. (Unlike the new H5N1 strain, this one can’t be transmitted from one mammal to another.)
But over the past decade, scientists have gotten worried that this kind of research could help someone trying to build biological weapons. In 2001, someone—we still don’t know who—unleashed terror by sending anthrax spores through the mail. In 2002, Eckard Wimmer, a Stony Brook University virologist, and his colleagues made headlines by synthesizing the genes for a poliovirus from scratch, and then making new viruses from them.* Their work raised the prospect of designer pathogens being created expressly to cause harm. The cost of sequencing and synthesizing DNA has crashed year after year, making biological engineering easier for people to do. All of these swift changes in biology led to the formation of the National Science Advisory Board for Biosecurity in 2004, made up of some of the country’s leading experts on microbiology and biological warfare.
Part of their charge was to review potentially dangerous research projects—what’s often called “dual use” research for its two-sided potential to be used for good or evil ends. For the first seven years of its existence, the board approached its mission with a very light touch. In 2005, for example, the board examined a study in which U.S. government scientists revived the 1918 virus. They had no objection to the scientists publishing the details of their research. In fact, you can see its genome on the Internet, too.
But now a pair of new studies has roused the board to action. Two teams of researchers, one in the Netherlands and one at the University of Wisconsin, have run experiments to find mutations that can turn H5N1 from a bird flu to a mammal flu. They’ve carried out their experiments on ferrets, which respond to flu viruses much like humans do. What few details we know of the unpublished research comes from a talk Dutch virologist Ron Fouchier gave in August at a virology conference, along with subsequent news reports. Fouchier began the experiment by altering the H5N1 virus’s genes in two spots. Then he passed the virus from one ferret to another, allowing the virus to mutate and evolve on its own inside the animals. After several rounds, Fouchier ended up with an H5N1 virus that could spread through the air from one ferret to the other. If unleashed—and if proven capable of spreading from human to human with the same high mortality rate—it could make the deadly 1918 pandemic look like a pesky cold.
The research is funded by the National Institutes of Health, and according to Anthony Fauci, director of the National Institute of Allergic and Infectious Diseases, NIH staffers were alarmed by the results. The studies were passed to the National Science Advisory Board for Biosecurity, which hashed out the matter for weeks. On Dec. 20, the panel urged that “conclusions of the manuscripts be published but without experimental details and mutation data that would enable replication of the experiments.”
Carl Zimmer writes frequently for the New York Times. His most recent book is Evolution: Making Sense of Life, co-authored with Douglas Emlen.




Wu-Tang’s GZA Teaches Kids Science With Least-Lame Classroom Rap Ever
“Stink Onions,” “Heart’s Farm,” “Place to Find Gold”: Literal Names of U.S. Places, Mapped
How Can You Survive in an Air Bubble 100 Feet Underwater for Three Days?